python - search sequence in genome with mismatches -


i have fastq file more 100 million reads in , genome sequence of 10000 in length

i want take out sequences fastq file , search in genome sequence allowing 3 mismatches

i tried in way using awk got sequences fastq file:

1.fq(few lines)

@dh1dqqn1:269:c1ukcacxx:1:1101:1207:2171 1:n:0:ttaggc natccccatcctctgcttgcttttcgggatatgttgtaggattctcagc

+

1=adbddhd;f>gf@ffefgggiaeei?d9ddhhigaaf:bg39?bb

@dh1dqqn1:269:c1ukcacxx:1:1101:1095:2217 1:n:0:ttaggc taggatttcaaatgggtcgaggtggtccgttaggtataggggcaacagg

+

??aabdd4c:dddi+c:c3@:c):1?*):?)?################

$ awk 'nr%4==2' 1.fq

natccccatcctctgcttgcttttcgggatatgttgtaggattctcagc taggatttcaaatgggtcgaggtggtccgttaggtataggggcaacagg

i have sequences in file,now want take each line of sequence , search in genome sequence allowing 3 mismatches , if finds print sequences

example:

genome sequence file:

ggggaggaatatgatttacagtttatttttcaactgtgcaaaataaccttaactgcagacgttatgacatacatacattctatgaattccactattttggaggactggaattttggtctacaacctcccccaggaggcacactagaagatacttataggtttgtaacccaggcaattgcttgtcaaaaacataca

search sequence file:

ggggaggaatatgat

ggggaggaatatgaa

ggggaggaatatgcc

tcaaaaacatagg

tcaaaaacatggg

output file:

ggggaggaatatgat 0 # 0 mismatch exact sequence

ggggaggaatatgaa 1 # 1 mismatch

ggggaggaatatgcc 2 # 2 mismatch

tcaaaaacatagg 2 # 2 mismatch

tcaaaaacatggg 3 # 3 mismatch

something like?

use 5.012; use strict; use warnings; use string::approx qw(aslice); use file::slurp; use data::dumper;  $genseq = "gseq.txt"; #the long sequence  $_ = read_file($genseq);  #read small patterns stdin while(my $patt = <>) {     chomp $patt;     $len = length($patt);     my($index, $size, $distance) = aslice($patt, ["3d0s3", "minimal_distance"]);     "$patt matched approx. @ $index mismatch $distance" if $distance <= 3; } 

for input produces:

ggggaggaatatgat matched approx. @ 0 mismatch 0 ggggaggaatatgaa matched approx. @ 0 mismatch 1 ggggaggaatatgcc matched approx. @ 0 mismatch 2 tcaaaaacatagg matched approx. @ 179 mismatch 2 tcaaaaacatggg matched approx. @ 179 mismatch 3 

honestly, haven't idea how work 10000 chars long genseq...


Comments

Popular posts from this blog

ruby - Nesting modules inside of a Rails eninge gem -

Eclipse formatter for java ending braces -

php - Why I am getting the Error "Commands out of sync; you can't run this command now" -